|
MathWorks Inc
matlab 2015a software Matlab 2015a Software, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab 2015a software/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab 2015a software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
2015a 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2015a/product/MathWorks Inc Average 90 stars, based on 1 article reviews
2015a - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab®2015a, v.8.5 for windows software Matlab®2015a, V.8.5 For Windows Software, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab®2015a, v.8.5 for windows software/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab®2015a, v.8.5 for windows software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
image acquisition image processing toolboxes release 2015a ![]() Image Acquisition Image Processing Toolboxes Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/image acquisition image processing toolboxes release 2015a/product/MathWorks Inc Average 96 stars, based on 1 article reviews
image acquisition image processing toolboxes release 2015a - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
MathWorks Inc
computing language software ![]() Computing Language Software, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/computing language software/product/MathWorks Inc Average 90 stars, based on 1 article reviews
computing language software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Sony
vaio laptop model vpceh2j1e ![]() Vaio Laptop Model Vpceh2j1e, supplied by Sony, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vaio laptop model vpceh2j1e/product/Sony Average 90 stars, based on 1 article reviews
vaio laptop model vpceh2j1e - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
run time compiler version 8 3 ![]() Run Time Compiler Version 8 3, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/run time compiler version 8 3/product/MathWorks Inc Average 96 stars, based on 1 article reviews
run time compiler version 8 3 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab 2014a/2015a ![]() Matlab 2014a/2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab 2014a/2015a/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab 2014a/2015a - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
r 2015a software ![]() R 2015a Software, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/r 2015a software/product/MathWorks Inc Average 90 stars, based on 1 article reviews
r 2015a software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab 2015a ![]() Matlab 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab 2015a/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab 2015a - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab 2011a-2015a ![]() Matlab 2011a 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab 2011a-2015a/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab 2011a-2015a - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell reports
Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion
doi: 10.1016/j.celrep.2019.09.045
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and
Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software